pcDNA3.1/Puro-CAG-JEDI3sub-mBeRFP(E6F)
(Plasmid
#246628)
-
PurposeGenetically encoded voltage indicator (GEVI) JEDI3sub with a 3xGSS linked mBeRFP E6F expressed under a strong mammalian promoter (CAG)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
- Backbone size w/o insert (bp) 6103
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI3sub-mBeRFP(E6F)
-
SpeciesSynthetic
-
Insert Size (bp)2010
-
MutationmBeRFP has an E6F mutation
- Promoter CAG
-
Tag
/ Fusion Protein
- mBeRFP(E6F) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was only used for screening and was not tested in vivo in the corresponding publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-JEDI3sub-mBeRFP(E6F) was a gift from Francois St-Pierre (Addgene plasmid # 246628 ; http://n2t.net/addgene:246628 ; RRID:Addgene_246628) -
For your References section:
Designer indicators for two-photon recording of subthreshold voltage dynamics. Land MA, Galdamez M, Villette V, Zhu J, Lu X, Marosi M, Yang S, Foran G, McDonald AJ, Dong X, Zaabout E, Liu H, Liu Z, Colbert KL, Lai S, Shorey M, Lourdiane ASG, Ayon A, Bradley J, Mailhes-Hamon C, Natan RG, Zhong J, Kroeger R, Law RG, Hakam N, Smith CL, Hu M, Tabb S, Bathellier B, Dudok B, Ji N, Bourdieu L, Reimer J, St-Pierre F. Nat Methods. 2026 Apr 15. doi: 10.1038/s41592-026-03043-8. 10.1038/s41592-026-03043-8 PubMed 41986688