Skip to main content

pcDNA3.1/Puro-CAG-JEDI3hyp-mBeRFP(E6F)
(Plasmid #246641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246641 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1/Puro-CAG
  • Backbone size w/o insert (bp) 6103
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JEDI3hyp-mBeRFP(E6F)
  • Species
    Synthetic
  • Insert Size (bp)
    2010
  • Mutation
    mBeRFP has an E6F mutation
  • Promoter CAG
  • Tag / Fusion Protein
    • mBeRFP(E6F) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was only used for screening and was not tested in vivo in the corresponding publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/Puro-CAG-JEDI3hyp-mBeRFP(E6F) was a gift from Francois St-Pierre (Addgene plasmid # 246641 ; http://n2t.net/addgene:246641 ; RRID:Addgene_246641)
  • For your References section:

    Designer indicators for two-photon recording of subthreshold voltage dynamics. Land MA, Galdamez M, Villette V, Zhu J, Lu X, Marosi M, Yang S, Foran G, McDonald AJ, Dong X, Zaabout E, Liu H, Liu Z, Colbert KL, Lai S, Shorey M, Lourdiane ASG, Ayon A, Bradley J, Mailhes-Hamon C, Natan RG, Zhong J, Kroeger R, Law RG, Hakam N, Smith CL, Hu M, Tabb S, Bathellier B, Dudok B, Ji N, Bourdieu L, Reimer J, St-Pierre F. Nat Methods. 2026 Apr 15. doi: 10.1038/s41592-026-03043-8. 10.1038/s41592-026-03043-8 PubMed 41986688