pLEX-VSV-G-Foldon-Intein-Cre
(Plasmid
#247729)
-
PurposeExpresses VSV-G, Foldon and Cre recombinase, separated by self-cleaving intein
-
Depositing Lab
-
Depositing OrganizationKarolinska Institutet
Located in Sweden -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLEX
- Backbone size w/o insert (bp) 4521
- Total vector size (bp) 7821
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSV-G-Foldon-Intein-Cre
-
Alt nameVFIC plasmid
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3300
- Promoter CAG
-
Tag
/ Fusion Protein
- VSV-G (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAA
- 3′ sequencing primer GGGCATTGGCCACACCAGCCACCACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX-VSV-G-Foldon-Intein-Cre was a gift from Samir El Andaloussi (Addgene plasmid # 247729 ; http://n2t.net/addgene:247729 ; RRID:Addgene_247729) -
For your References section:
Engineering of extracellular vesicles for efficient intracellular delivery of multimodal therapeutics including genome editors. Liang X, Gupta D, Xie J, Van Wonterghem E, Van Hoecke L, Hean J, Niu Z, Ghaeidamini M, Wiklander OPB, Zheng W, Wiklander RJ, He R, Mamand DR, Bost J, Zhou G, Zhou H, Roudi S, Estupinan HY, Radler J, Zickler AM, Gorgens A, Hou VWQ, Slovak R, Hagey DW, de Jong OG, Uy AG, Zong Y, Mager I, Perez CM, Roberts TC, Carter D, Vader P, Esbjorner EK, de Fougerolles A, Wood MJA, Vandenbroucke RE, Nordin JZ, El Andaloussi S. Nat Commun. 2025 Apr 29;16(1):4028. doi: 10.1038/s41467-025-59377-y. 10.1038/s41467-025-59377-y PubMed 40301355