Skip to main content
Addgene
Open Menu

gPPP2R1A_Cas13_dsred
(Plasmid #248705)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248705 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    Cas13_DR1_dsRed-T2A-Puro
  • Backbone manufacturer
    Dr. Christian J. Braun
  • Backbone size w/o insert (bp) 9425
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPP2R1A
  • gRNA/shRNA sequence
    GAATAAAATAAAAACGGCACAGT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    23
  • Entrez Gene
    PPP2R1A (a.k.a. HJS2, MRD36, PP2A-Aalpha, PP2AA, PP2AAALPHA, PR65A)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer taccgagggcctatttccca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gPPP2R1A_Cas13_dsred was a gift from Günter Schneider (Addgene plasmid # 248705 ; http://n2t.net/addgene:248705 ; RRID:Addgene_248705)

  • For your References section:

    The Protein Phosphatase Inhibitor LB100 Targets the Mesenchymal Lineage of Pancreatic Ductal Adenocarcinoma. Murr J, Schneider C, Duan N, Kose H, Rajamani A, He X, Buchloh J, Hintze C, Naik A, Goeke D, Rjasanow N, Krauss L, Nguyen A, Widholz SA, Schneeweis C, Trozzo R, Orben F, Mueller S, Ollinger R, Montero JJ, Dudek M, Knolle P, Kong B, Ellenrieder V, Contreras CT, Hessmann E, Grade M, Ghadimi M, Braun CJ, Rad R, Reichert M, Keller U, Schmid RM, Boutz PL, Saur D, Wirth M, Kramer OH, Schneider G. MedComm (2020). 2026 Jun 7;7(6):e70794. doi: 10.1002/mco2.70794. eCollection 2026 Jun. 10.1002/mco2.70794 PubMed 42266180
Related items: