EPI-CAG-SauriCas9-ZsGreen-puroR-dualU6-sgRNA
(Plasmid #249830)

• Purpose: Episomal CAG-SauriCas9-ZsGreen-puroR vector with dual U6 sgRNA cassettes for CRISPR editing in mammalian cells.
• Depositing Lab: Bin Yu
• Depositing Organization: Shanghai Jiao Tong University, School of Medicine
  Located in China
• Publication: Chen et al Commun Biol. 2025 Dec 29;9(1):159. doi: 10.1038/s42003-025-09437-2.

Backbone

• Vector backbone: epiCRISPR plasmid
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None
• gRNA/shRNA sequence: TATCCGACTGTGACTCCTCC
• Species: M. musculus (mouse)
• Entrez Gene: Trp53 (a.k.a. Tp53, bbl, bfy, bhy, p44, p53)
• Promoter: CAG and U6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: Not applicable
• 3′ sequencing primer: Not applicable

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Due to its repetitive and G/C-rish nature, Addgene NGS is unable to fully resolve the EBNA1 element within the plasmid. Also, this plasmid contains an A nucleotide deletion immediately upstream of the gRNA sequence and a ten amino acid insertion between nucleoplasmin NLS and T2A. These differences are not known to impact plasmid function.