Skip to main content
Addgene
Open Menu

pAAV-mDlx-SynaptoTAG2
(Plasmid #250438)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250438 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 7537
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-Synaptobrevin-2, tdTomato
  • Insert Size (bp)
    2577
  • GenBank ID
  • Promoter mDlx
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • tdTomato (P2A cleavage) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer tgcggccgcacgcgtttaattaagaattctata
  • 3′ sequencing primer tggcggatcctactagtttcttaagagctgtaat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Wei Xu and Gordon Fishell. This plasmid was constructed by replacing the hSyn promoter sequence in the pAAV-SynaptoTAG2 plasmid (Wei Xu, Addgene #175275) with the mDlx enhancer sequence from the pAAV-mDlx-GFP plasmid (Gordon Fishell, Addgene #83900) using MluI and BamHI restriction sites introduced at the ends of the mDlx sequence.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2026.06.06.730551 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-mDlx-SynaptoTAG2 was a gift from Takuma Kitanishi (Addgene plasmid # 250438)

  • For your References section:

    GABAergic projection from the subiculum to the medial entorhinal cortex in mice and rats. Aimi T, Shibuya T, Umeno H, Karasawa K, Tsutsui K-I, Ohara S, Kitanishi T. bioRxiv 2026.06.06.730551 10.64898/2026.06.06.730551
Related items: