pBbS5a-OptoCre-REDMAP-PCB
(Plasmid #250735)

• Purpose: Light-inducible Cre recombinase split with REDMAP photoreceptors for bacterial expression
• Depositing Lab: Mary Dunlop
• Publication: Huang et al iScience. 2026 Feb 24;29(3):115133. doi: 10.1016/j.isci.2026.115133. eCollection 2026 Mar 20.

Backbone

• Vector backbone: pBbS5a
• Backbone size w/o insert (bp): 5837
• Total vector size (bp): 10388
• Vector type: Bacterial Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: OptoCre-REDMAP
• Alt name: OptoCre-REDMAP
• Species: Synthetic
• Insert Size (bp): 3799
• Promoter: pLacUV5

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcgtagaggatcgagatcgtttaggcaccc

Gene/Insert 2

• Gene/Insert name: Ho1
• Species: Synthetic
• Insert Size (bp): 722
• Promoter: J23108

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAGTAAATCACTGCATAATTCGTGTCG

Gene/Insert 3

• Gene/Insert name: PcyA
• Species: Synthetic
• Insert Size (bp): 744
• Promoter: J23106

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGTGTTCAACAGCCTCACCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry