Skip to main content
Addgene
Open Menu

pAT159_AAV_p3_PE7-C_hU6_epegRNA
(Plasmid #251105)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251105 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    puc19
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PE7 C-terminal
  • gRNA/shRNA sequence
    pegRNA cloning casette
  • Promoter p3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcggcctctagatcagggta
  • 3′ sequencing primer gcggccgcAAGGTCGGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT159_AAV_p3_PE7-C_hU6_epegRNA was a gift from Gerald Schwank (Addgene plasmid # 251105 ; http://n2t.net/addgene:251105 ; RRID:Addgene_251105)

  • For your References section:

    RNA-LNP-mediated in vivo prime editing corrects disease phenotypes in a mouse model of citrullinemia type I. Talas A, Ioannidi EI, Weber Y, Haenggi T, Kulcsar PI, Zurcher N, Faccin E, Moon WJ, Kissling L, Villiger EA, Matsushita M, Rothgangl T, Janjuha S, Lin PJC, Poms M, Muramatsu H, Vadovics M, Reichmuth A, Kopf M, Pardi N, Tam YK, Haberle J, Schwank G. Sci Transl Med. 2026 May 13;18(849):eaec7274. doi: 10.1126/scitranslmed.aec7274. Epub 2026 May 13. 10.1126/scitranslmed.aec7274 PubMed 42127219
Related items: