pMTL-YN1C PslpA::mNG
(Plasmid
#251225)
-
PurposepMTL-YN1C encoding mNeonGreen under the promoter for slpA. This functions as a constitutive transcriptional reporter for visualizing C. difficile
-
Depositing Lab
-
Depositing OrganizationTufts University
Located in the United States of America -
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMTL-YN1C
- Backbone size w/o insert (bp) 6064
- Total vector size (bp) 7076
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePslpA::mNeonGreen
-
SpeciesC. difficile
-
Insert Size (bp)1012
- Promoter slpA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgatgagtgtcctttatgtaagg
- 3′ sequencing primer taacgccagggttttccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTL-YN1C PslpA::mNG was a gift from Aimee Shen (Addgene plasmid # 251225 ; http://n2t.net/addgene:251225 ; RRID:Addgene_251225)
Map uploaded by the depositor.
