pAAV-EF1α-GRAB_PGE2mut
(Plasmid
#251356)
-
PurposeExpress the PGE2-insensitive control sensor GRAB_PGE2mut in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5119
- Total vector size (bp) 7029
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePGE2-insensitive sensor GRAB_PGE2mut (control sensor)
-
Alt namePGE2mut
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1917
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgtgaggtaccggatcctctagagtcgacatggagacagacacactcct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.01.657218 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-GRAB_PGE2mut was a gift from Yulong Li (Addgene plasmid # 251356 ; http://n2t.net/addgene:251356 ; RRID:Addgene_251356) -
For your References section:
A genetically encoded fluorescent sensor for monitoring spatiotemporal prostaglandin E2 dynamics in vivo. Wang L, Yang Y, Deng F, Yan Y, Li Y. bioRxiv [Preprint]. 2025 Jun 3:2025.06.01.657218. doi: 10.1101/2025.06.01.657218. 10.1101/2025.06.01.657218 PubMed 40501671