pGA2-GK-Ec- OMeYRS-4xtRNA
(Plasmid #251518)

• Purpose: TAG suppression of sfGFP150TAG using the E. coli TyrRS/tRNA system for incorporation of trifluoromethyl-phenylalanine (tfm-Phe) mammalian cells
• Depositing Lab: Ryan Mehl
• Depositing Organization: Oregon State University
  Located in the United States of America
• Publication: Augustin et al J Am Chem Soc. 2026 Feb 12. doi: 10.1021/jacs.5c18349.

Backbone

• Vector backbone: pGA2
• Backbone size w/o insert (bp): 5383
• Total vector size (bp): 6667
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ec. OMeYRS
• Alt name: Ec.Y-RS
• Species: Synthetic
• Insert Size (bp): 1284
• Promoter: pGK

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cgtttaaacttaagcttgccaccatggcaagca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The mammalian expression plasmid pGA2-GK-Ec-OMeYRS-4xtRN was generated by combining elements from pIRE4-Azi (https://pubmed.ncbi.nlm.nih.gov/28771403) (Addgene #105829) and pAcBac3-OMeYRS-8xYtR-EGFP-3TAA-40TGA-152TAG-TEV-3xUAA (Addgene #228787). pIRE4-Azi encodes a humanized EcTyrRS mutant EAziRS (37L/186A/265R, end sequence ICWK), evolved for p-azidophenylalanine incorporation in mammalian cells, together with four U6-driven B. stearothermophilus tRNATyrCUA​ (BstYam) cassettes. The EAziRS open reading frame was removed and replaced with the EcTyr OMeYRS coding sequence (37V/186L/265D, end sequence ICWKGPV) from pAcBac3-OMeYRS (https://doi.org/10.1016/j.chembiol.2018.07.002) which encodes a thermostabilized O-methyl-L-tyrosine-specific EcTyrRS variant (OMeYRS-VSMA*) initially developed by Italia et al. for improved OMeY incorporation. The resulting plasmid, therefore, retains the mPGK promoter and 4× U6–BstYam tRNACUA​ cassette architecture of pIRE4-Azi while expressing the OMeYRS-derived EcTyrRS variant from the Osgood et al baculoviral triple-suppression system.