pLenti mCherry-TFEB Hygro
(Plasmid
#252409)
-
PurposeExpresses a mCherry-TFEB fusion protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti4/TO/V5-DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8932
- Total vector size (bp) 11089
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-TFEB fusion
-
SpeciesH. sapiens (human); Discosoma sp.
-
Insert Size (bp)2157
-
GenBank IDAY678264 NM_007162
-
Entrez GeneTFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer tggatctctgctgtccctgt
- 3′ sequencing primer AATTCCCCAATGTCAAGCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLaboratory of Ritva Tikkanen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti mCherry-TFEB Hygro was a gift from Frank Schnütgen (Addgene plasmid # 252409 ; http://n2t.net/addgene:252409 ; RRID:Addgene_252409)