Skip to main content

pLenti mCherry-TFEB Hygro
(Plasmid #252409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252409 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti4/TO/V5-DEST
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8932
  • Total vector size (bp) 11089
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-TFEB fusion
  • Species
    H. sapiens (human); Discosoma sp.
  • Insert Size (bp)
    2157
  • GenBank ID
    AY678264 NM_007162
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer tggatctctgctgtccctgt
  • 3′ sequencing primer AATTCCCCAATGTCAAGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Laboratory of Ritva Tikkanen

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti mCherry-TFEB Hygro was a gift from Frank Schnütgen (Addgene plasmid # 252409 ; http://n2t.net/addgene:252409 ; RRID:Addgene_252409)