Skip to main content
Addgene
Open Menu

huCofilin K22Q SSR-mRFP
(Plasmid #252617)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 252617 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 252617-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 252617-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pmRFP-N1
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1
  • Species
    H. sapiens (human)
  • Mutation
    K22Q; silent mutations at nt 67 to 75 in which TCTTCAACG is replaced with AGCTCAACC and nt 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV
  • Tag / Fusion Protein
    • mRFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SSR is super resistent to cofilin shRNA (silent mutations in 2 different seqences). Silent mutations protect expression against 2 human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) targeting different sequences in cofilin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    huCofilin K22Q SSR-mRFP was a gift from James Bamburg (Addgene plasmid # 252617 ; http://n2t.net/addgene:252617 ; RRID:Addgene_252617)

  • For your References section:

    ADF/cofilin regulates actomyosin assembly through competitive inhibition of myosin II binding to F-actin. Wiggan O, Shaw AE, DeLuca JG, Bamburg JR. Dev Cell. 2012 Mar 13;22(3):530-43. doi: 10.1016/j.devcel.2011.12.026. 10.1016/j.devcel.2011.12.026 PubMed 22421043
Related items: