pSX018 BAC-phagemid CmR(TAG)
(Plasmid
#253999)
-
PurposeBAC-phagemid for LySE, carrying CmR(TAG) for fluctuation analysis. Yeast origin (CEN) and selection (URA3) facilitates assembly in yeast.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneBAC-phagemid
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10174
-
Modifications to backboneYeast origin (CEN) and selection marker (URA3) for assembly in yeast.
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCmR(TAG)
-
SpeciesE. coli
-
Insert Size (bp)900
Cloning Information
- Cloning method Other
- 5′ sequencing primer ttacgccccgccctgccactcatcg
- 3′ sequencing primer gttggaacctcttacgtgccgatca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSX018 BAC-phagemid CmR(TAG) was a gift from Julius Fredens (Addgene plasmid # 253999 ; http://n2t.net/addgene:253999 ; RRID:Addgene_253999) -
For your References section:
Bridging continuous and discrete evolution through a controllable, hypermutagenic phage-bacteria system. Ong S, Ghode P, Narenderan A, Lao S, Willenborg F, Eden TV, Marsh CO, Yew WS, Fredens J. Nat Microbiol. 2026 May 1. doi: 10.1038/s41564-026-02346-y. 10.1038/s41564-026-02346-y PubMed 42067623