Skip to main content

pSX018 BAC-phagemid CmR(TAG)
(Plasmid #253999)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253999 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    BAC-phagemid
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10174
  • Modifications to backbone
    Yeast origin (CEN) and selection marker (URA3) for assembly in yeast.
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CmR(TAG)
  • Species
    E. coli
  • Insert Size (bp)
    900

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer ttacgccccgccctgccactcatcg
  • 3′ sequencing primer gttggaacctcttacgtgccgatca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSX018 BAC-phagemid CmR(TAG) was a gift from Julius Fredens (Addgene plasmid # 253999 ; http://n2t.net/addgene:253999 ; RRID:Addgene_253999)
  • For your References section:

    Bridging continuous and discrete evolution through a controllable, hypermutagenic phage-bacteria system. Ong S, Ghode P, Narenderan A, Lao S, Willenborg F, Eden TV, Marsh CO, Yew WS, Fredens J. Nat Microbiol. 2026 May 1. doi: 10.1038/s41564-026-02346-y. 10.1038/s41564-026-02346-y PubMed 42067623