pML104-KanMX-sgRNAv2
(Plasmid #254712)

• Purpose: Yeast CRISPR-Cas9 backbone with sgRNA cassette for rapid PCR-based guide insertion; KanMX/G418 selection in S. cerevisiae, Amp/Kan propagation in E. coli.
• Depositing Lab: Brian Strahl
• Publication: Rostamian et al STAR Protoc. 2026 Jul 28;7(3):104751. doi: 10.1016/j.xpro.2026.104751.

Backbone

• Vector backbone: pML104
• Backbone manufacturer: John Wyrick lab
• Backbone size w/o insert (bp): 11240
• Modifications to backbone: KanMX cassette with TEF promoter/terminator is inserted. The gRNA scaffold is modified. Guide sequence is designed for the yKu70 gene.
• Vector type: Yeast Expression, CRISPR
• Selectable markers: Neomycin (select with G418), URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YKU70 sgRNA
• gRNA/shRNA sequence: cagaatcctaaggaaaaagg
• Species: S. cerevisiae (budding yeast)
• GenBank ID:
• Entrez Gene: YKU70 (a.k.a. YMR284W, HDF1, NES24)
• Promoter: SNR52 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGAAGGACTACAACGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG
• 3′ sequencing primer: GTTGTAGTCCTTCACGCTGATCATTTATCTTTCACTGCGGAGAAGTTTCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The parent plasmid was provided by Daniel Isom (Associate Professor of Molecular and Cellular Pharmacology, University of Miami). In our lab, we modified this plasmid by inserting a YKU70-targeting guide RNA sequence into the sgRNA cassette.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains an example guide sequence targeting **YKU70**. As described in our protocol paper, the guide sequence can be easily changed by designing forward and reverse primers for a new target and then using PCR and seamless plasmid recircularization.