pML104-KanMX-sgRNAv2
(Plasmid
#254712)
-
PurposeYeast CRISPR-Cas9 backbone with sgRNA cassette for rapid PCR-based guide insertion; KanMX/G418 selection in S. cerevisiae, Amp/Kan propagation in E. coli.
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepML104
-
Backbone manufacturerJohn Wyrick lab
- Backbone size w/o insert (bp) 11240
-
Modifications to backboneKanMX cassette with TEF promoter/terminator is inserted. The gRNA scaffold is modified. Guide sequence is designed for the yKu70 gene.
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418), URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYKU70 sgRNA
-
gRNA/shRNA sequencecagaatcctaaggaaaaagg
-
SpeciesS. cerevisiae (budding yeast)
-
GenBank ID
-
Entrez GeneYKU70 (a.k.a. YMR284W, HDF1, NES24)
- Promoter SNR52 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGAAGGACTACAACGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG
- 3′ sequencing primer GTTGTAGTCCTTCACGCTGATCATTTATCTTTCACTGCGGAGAAGTTTCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe parent plasmid was provided by Daniel Isom (Associate Professor of Molecular and Cellular Pharmacology, University of Miami). In our lab, we modified this plasmid by inserting a YKU70-targeting guide RNA sequence into the sgRNA cassette.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains an example guide sequence targeting **YKU70**. As described in our protocol paper, the guide sequence can be easily changed by designing forward and reverse primers for a new target and then using PCR and seamless plasmid recircularization.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML104-KanMX-sgRNAv2 was a gift from Brian Strahl (Addgene plasmid # 254712 ; http://n2t.net/addgene:254712 ; RRID:Addgene_254712) -
For your References section:
Protocol for CRISPR genome editing in S. cerevisiae using PCR-based guide insertion. Rostamian H, Madden EW, Kaplan FM, Kim RS, Isom DG, Strahl BD. STAR Protoc. 2026 Jul 28;7(3):104751. doi: 10.1016/j.xpro.2026.104751. 10.1016/j.xpro.2026.104751 PubMed 42519825