pcDNA3.1-hMOR-rLuc8
(Plasmid
#254716)
-
PurposeExpresses human wildtype mu opioid receptor (MOR) with C-terminal rLuc8. Vector used for G protein recruitment or 'nuc-BRET' assay.
-
Depositing Lab
-
Depositing OrganizationUniversity of Southern California
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 7636
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman mu opioid receptor
-
Alt nameOPRM
-
SpeciesH. sapiens (human)
-
Entrez GeneOPRM1 (a.k.a. LMOR, M-OR-1, MOP, MOR, MOR1, OPRM)
- Promoter CMV
-
Tags
/ Fusion Proteins
- rLuc8 (C terminal on insert)
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-hMOR-rLuc8 was a gift from Cornelius Gati (Addgene plasmid # 254716 ; http://n2t.net/addgene:254716 ; RRID:Addgene_254716) -
For your References section:
Structural snapshots capture nucleotide release at the mu-opioid receptor. Khan S, Tyson AS, Ranjbar M, Zhang Z, Singh J, Han GW, Gati C. Nature. 2025 Dec;648(8094):755-763. doi: 10.1038/s41586-025-09677-6. Epub 2025 Nov 5. 10.1038/s41586-025-09677-6 PubMed 41193810