pcDNA3.1-Gαi1-Gβ1-Gγ2-GFP2
(Plasmid
#254719)
-
PurposeExpresses G protein heterotrimer with Gαi1, Gβ1 and Gγ2-GFP2 fusion. Vector used for G protein recruitment or 'nuc-BRET' assay. Based on TRUPATH Triple Gαi1 (#196048).
-
Depositing Lab
-
Depositing OrganizationUniversity of Southern California
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) -8
- Total vector size (bp) 7824
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGαi1
-
Alt nameGNAI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)-6
-
Entrez GeneGNAI1 (a.k.a. Gi, HG1B, NEDHISB)
- Promoter IRES
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAGAGGAAGTCTTCTAACATGCGGTGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGβ1
-
Alt nameGNB1
-
SpeciesH. sapiens (human)
-
Entrez GeneGNB1 (a.k.a. HG2A, MDS, MRD42)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameGγ2
-
Alt nameGNG2
-
SpeciesH. sapiens (human)
-
Entrez GeneGNG2 (a.k.a. HG3F1)
- Promoter T2A
-
Tag
/ Fusion Protein
- GFP2 (N terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gtctaggccccccgaaccacg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Gαi1-Gβ1-Gγ2-GFP2 was a gift from Cornelius Gati (Addgene plasmid # 254719 ; http://n2t.net/addgene:254719 ; RRID:Addgene_254719) -
For your References section:
Structural snapshots capture nucleotide release at the mu-opioid receptor. Khan S, Tyson AS, Ranjbar M, Zhang Z, Singh J, Han GW, Gati C. Nature. 2025 Dec;648(8094):755-763. doi: 10.1038/s41586-025-09677-6. Epub 2025 Nov 5. 10.1038/s41586-025-09677-6 PubMed 41193810