pLV_UCOE-EF1a_3XHA-FPR1
(Plasmid
#254851)
-
PurposeMammalian expression of the human formyl peptide receptor FPR1 with an N-terminal 3x HA tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti 2nd gen
- Backbone size w/o insert (bp) 9750
- Total vector size (bp) 10892
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3xHA-FPR1
-
Alt nameFPR1
-
Alt nameFormyl Peptide Receptor 1
-
Alt nameFPR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1131
-
GenBank IDNM_002029
-
Entrez GeneFPR1 (a.k.a. FMLP, FPR)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- 3x HA tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtggagactgaagttaggcca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_UCOE-EF1a_3XHA-FPR1 was a gift from Sean R Collins (Addgene plasmid # 254851 ; http://n2t.net/addgene:254851 ; RRID:Addgene_254851) -
For your References section:
Parallel CRISPR screens reveal pathways controlling the cell surface levels of the attractant receptor FPR1. Akdogan E, Lundgren SM, Kamber RA, Bassik MC, Collins SR. Commun Biol. 2026 Mar 25. doi: 10.1038/s42003-026-09878-3. 10.1038/s42003-026-09878-3 PubMed 41882347