pEGFP-TANGO1S^PRD
(Plasmid #256127)

• Purpose: Expresses GFP-tagged human TANGO1S with the PRD domain deleted
• Depositing Lab: Nicola Stevenson
• Depositing Organization: University of Bristol
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Distinct roles for TANGO1S domains in maintaining ER-Golgi architecture | Journal of Cell Science | The Company of Biologists (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 6333
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TANGO1S^PRD
• Species: H. sapiens (human)
• Insert Size (bp): 1599
• Mutation: PRD domain deleted - amino acids 528-779
• GenBank ID: NM_001300867.2
• Entrez Gene: MIA3 (a.k.a. D320, ODCD2, TANGO, TANGO1, UNQ6077)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry