CTp130-Reporter-NT
(Plasmid
#256440)
-
PurposeMammalian expression of a TSM with half of GFP-2A-BFP with non-targeting spacer
-
Depositing Lab
-
Depositing OrganizationArc Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneUnspecified
-
Vector typeMammalian Expression
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTrans-splicing module with half of GFP-2A-BFP with non-targeting spacer
-
gRNA/shRNA sequenceTCACCAGAAGCGTACCATACTCACGAACAG
-
SpeciesSynthetic
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CTp130-Reporter-NT was a gift from Patrick Hsu (Addgene plasmid # 256440 ; http://n2t.net/addgene:256440 ; RRID:Addgene_256440) -
For your References section:
Rewriting endogenous human transcripts with dual CRISPR-guided 3' trans-splicing. Chandrasekaran SS, Tau C, Fu BXH, Nemeth M, Bartie L, Pawluk A, Konermann S, Hsu PD. Cell Syst. 2026 Feb 18;17(2):101487. doi: 10.1016/j.cels.2025.101487. Epub 2026 Feb 6. 10.1016/j.cels.2025.101487 PubMed 41653914