pG+DualMarker3
(Plasmid #256760)

• Purpose: This plasmid is a derivative of pG+Host9 plasmid, and compatible for upp based marker less gene editing.
• Depositing Lab: Gary Huffnagle
• Depositing Organization: University of Michigan
  Located in the United States of America
• Publication: Ravi et al J Bacteriol. 2026 Jun 29:e0010026. doi: 10.1128/jb.00100-26.

Backbone

• Vector backbone: pG+host9
• Total vector size (bp): 5203
• Vector type: Chromosomal integration
• Selectable markers: The upp gene can be used as a counter selectable marker, when used along with a upp mutant strain.

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Cells can be grown at temperatures greater than 37°C to dilute the plasmid out of the culture.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: upp
• Species: Lactobacillus acidophilus
• Insert Size (bp): 627
• GenBank ID: WP_003546738

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gccctgatagacggtgttaagccagccccgacac
• 3′ sequencing primer: tccctagactctagaggatcttggttgataatgaactgtgctgattacaaaaatact

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The lacZ gene was obtained from the pBluescript II SK+ plasmid, a gift from Dr. Amy Chang. The upp expression cassette was obtained from the pMZ7 plasmid, a gift from Dr. Meilin Zhu

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A A203T mutation was identified in repB; this mutation does not affect plasmid function.