pColA-PUM2-TS-BINOCULAR-P10-P12
(Plasmid
#257831)
-
PurposeToehold Switch sensor with BINOCULAR reporter for rapid, lateral flow assay based detection of a mammalian cell internal control (PUM2) gene.
-
Depositing Lab
-
Depositing OrganizationBoston University Main Campus
Located in the United States of America -
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCOLAduet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePUM2 toehold switch _BINOCULAR-P10-P12 reporter
-
SpeciesSynthetic
-
Insert Size (bp)457
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgttactggtttcacattcaccaccc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pColA-PUM2-TS-BINOCULAR-P10-P12 was a gift from Alexander Green (Addgene plasmid # 257831 ; http://n2t.net/addgene:257831 ; RRID:Addgene_257831) -
For your References section:
Bispecific Coiled-Coil Reporters Enable Rapid, Multiplexed Detection of Mycoplasma via Toehold Switch Sensors. Li Y, Arevalos NR, Eshed A, Newell S, Frisch C, Kang NR, Wang X, Brafman DA, Green AA. ACS Synth. Biol. (2026) 10.1021/acssynbio.6c00465
Map uploaded by the depositor.
