Skip to main content
Addgene
Open Menu

pSBi-double-mStayGold
(Plasmid #258169)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258169 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pSBbi-Pur
  • Backbone manufacturer
    Eric Kowarz, Addgene plasmid #60523
  • Backbone size w/o insert (bp) 6392
  • Total vector size (bp) 7089
  • Modifications to backbone
    mStayGold also inserted after the RPBSA promoter for more uniform and brighter fluorescence
  • Vector type
    Mammalian Expression ; Sleeping beauty transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mStayGold
  • Species
    Cytaeis uchidae
  • Insert Size (bp)
    681
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TAGAAGGCACAGTCGAGG
  • 3′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Received Backbone from Eric Kowarz and Rolf Marschalek (directly), Insert from the Janelia integrative imaging lab (through Addgene). Permissions for distribution were obtained.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBi-double-mStayGold was a gift from Thomas Zech (Addgene plasmid # 258169 ; http://n2t.net/addgene:258169 ; RRID:Addgene_258169)

  • For your References section:

    Lanostane-type triterpenoids from ethnomedicinal fungi inhibit endothelial cell proliferation. Achenbach J, Wasilewicz A, Roggio AP, Grienke U, Beniddir MA, Zech TJ, Rollinger JM, Furst R, Kirchweger B. J Ethnopharmacol. 2026 May 6;368:121799. doi: 10.1016/j.jep.2026.121799. 10.1016/j.jep.2026.121799 PubMed 42102927
Related items: