Skip to main content
Addgene
Open Menu

pLVH-EF1a-AcGFP-P2A-SCD(KH450)
(Plasmid #259305)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259305 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pLVH-EF1a.AcGFP-P2A-2SmaI(KH169)
  • Backbone manufacturer
    Hu Lab
  • Backbone size w/o insert (bp) 8317
  • Total vector size (bp) 10159
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    It is recommended that this plasmid is grown in E. coli strain Stbl3 to reduce the chance of mutation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    stearoyl-CoA desaturase
  • Alt name
    SCD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1080
  • GenBank ID
    NM_005063
  • Entrez Gene
    SCD (a.k.a. FADS5, MSTP008, SCD1, SCDOS, hSCD1)
  • Promoter EF1a promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer LVX-XbaI-F(p5): cacggcatggatgagctgta
  • 3′ sequencing primer LVHEcoRI-R(Hu Lab primer, p21): ccagtcaatctttcacaaat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We cloned it

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVH-EF1a-AcGFP-P2A-SCD(KH450) was a gift from Kejin Hu (Addgene plasmid # 259305 ; http://n2t.net/addgene:259305 ; RRID:Addgene_259305)

  • For your References section:

    BRD2 impedes iPSC reprogramming by regulating lipid biosynthesis and the matrisome via its ET tail. Cevallos RR, Zhang R, Sian R, Chen SG, Hu K. Commun Biol (2026). doi: 10.1038/s42003-026-10691-1 10.1038/s42003-026-10691-1
Related items: