BRD2 impedes iPSC reprogramming by regulating lipid biosynthesis and the matrisome via its ET tail
Cevallos RR, Zhang R, Sian R, Chen SG, Hu K
Commun Biol (2026). doi: 10.1038/s42003-026-10691-1
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 258553 | pLVH-EF1a.AcGFP-P2A-2SmaI(KH169) | This is our optimized transfer plasmid for lentiviral vector system. It features GFP co-expression via P2A peptide. Transgene is cloned downstream of GFP vial P2A linker peptide. Hu lab code is KH169. |
| 258555 | pLKO.1-puro-shBRD2(KH361) | shRNA knockdown against human BRD2, clone 2. The shRNA was cloned into pLKO.1 TCR1 vector. Sense sequence: CCGGAGGAAGAAGAGAGTGAAAGCTCTCGAGAGCTTTCACTCTCTTCTTCCTTTTTTG. Hu lab code KH361 |
| 258560 | pTRIPZ-EC-hBRD2shRNA(KH320) | Inducible shRNA against human BRD2 on optimized TRIPZ vector. Lab code is KH320. |
| 259305 | pLVH-EF1a-AcGFP-P2A-SCD(KH450) | This is the lentiviral transfer plasmid with human SCD gene (Stearoyl-CoA desaturase) with co-expression of GFP via P2A peptide. Hu lab code is KH450. |
| 259307 | pLVH-EF1a-AcGFP-P2A-FLAG-hBRD2^ET (KH356) | Human BRD2 with its ET tail deleted. It has a FLAG tag at N terminus. Hu lab code is KH356. |