pLKO.1-puro-shBRD2(KH361)
(Plasmid #258555)

• Purpose: shRNA knockdown against human BRD2, clone 2. The shRNA was cloned into pLKO.1 TCR1 vector. Sense sequence: CCGGAGGAAGAAGAGAGTGAAAGCTCTCGAGAGCTTTCACTCTCTTCTTCCTTTTTTG. Hu lab code KH361
• Depositing Lab: Kejin Hu
• Depositing Organization: University of North Texas Health Science Center
  Located in the United States of America
• Publication: Cevallos et al Commun Biol (2026). doi: 10.1038/s42003-026-10691-1

Backbone

• Vector backbone: PLKO.1-puro
• Backbone manufacturer: Millipore Sigma
• Backbone size w/o insert (bp): 7032
• Total vector size (bp): 7081
• Modifications to backbone: Insert hairpin shRNA
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human bromodomain extra terminal protein 2
• Alt name: BRD2
• Species: H. sapiens (human)
• Insert Size (bp): 57
• GenBank ID: NM_005104
• Entrez Gene: BRD2 (a.k.a. BRD2-IT1, D6S113E, FSH, FSHRG1, FSRG1, NAT, O27.1.1, RING3, RNF3)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: FwdU6-2 (p176): cgatacaaggctgttagagagataatt
• 3′ sequencing primer: 5cPPT-R-seq (P175): ctactattctttcccctgcactg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry