pLVH-EF1a.AcGFP-P2A-2SmaI(KH169)
(Plasmid #258553)

• Purpose: (Empty Backbone) This is our optimized transfer plasmid for lentiviral vector system. It features GFP co-expression via P2A peptide. Transgene is cloned downstream of GFP vial P2A linker peptide. Hu lab code is KH169.
• Depositing Lab: Kejin Hu
• Depositing Organization: University of North Texas Health Science Center
  Located in the United States of America
• Publication: Cevallos et al Commun Biol (2026). doi: 10.1038/s42003-026-10691-1

Backbone

• Vector backbone: pLVX-AcGFP-C1
• Backbone manufacturer: Clontech, 632155
• Backbone size (bp): 8787
• Modifications to backbone: Here is the modification note from our Nature Communication paper: "(1) replacement of CMV promoter with EF1α promoter because we found that CMV promoter is silenced prematurely during reprogramming. Transgenes in our constructs are not prematurely silenced as shown by the expression of GFP at day 16 of the reprogramming colonies (Supplementary Fig. 1h) since GFP is co-expressed with reprogramming factors mediated by 2A sequence; (2) removal of PGK promoter and puromycin resistant gene to reduce the size of vector for enhanced packaging; (3) realization of GFP co-expression with the reprogramming factor via the short and efficient P2A self-cleavage peptide."
• Vector type: Mammalian Expression, Lentiviral
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • no

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: It is recommended that this plasmid is grown in E. coli strain Stbl3 to reduce the chance of mutation.
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: LVX-XbaI-F (Hu lab, p5): cacggcatggatgagctgta
• 3′ sequencing primer: LVHEcoRI-R (Hu lab primer: p21): ccagtcaatctttcacaaat

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone is from Clontech, 632155, but we conducted extensive modifications.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This modified lentiviral vector allows high titer of lentivirus packaging, and it is not easy to be silenced due to the use of EF1a promoter rather than the original CMV promoter. It also allows cloning of any transgenes downstream of GFP via P2A peptide. It provides robust co-expression of GFP and transgene.