pMV306G13+FFluc
(Plasmid
#26157)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMV306
- Backbone size w/o insert (bp) 3995
-
Vector typeMycobacteria integrating vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameG13 promoter + Firefly luciferase
-
Alt nameFFluc
-
Alt nameLuc
-
SpeciesMycobacterium marinum + Photinus pyralis
-
Insert Size (bp)2155
-
MutationCodon optimized for Mycobacterium tuberculosis. Lacks the last 3 aa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gatcgccactagcgccgcgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFirefly luciferase gene codon optimised for Mycobacterium was cloned from pJ246:17659 obtained from Jeff Cirillo (Texas A&M) and Kevin Francis (Caliper Life Sciences)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306G13+FFluc was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26157 ; http://n2t.net/addgene:26157 ; RRID:Addgene_26157) -
For your References section:
Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722