This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMV306hsp+LuxG13
(Plasmid #26161)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26161 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bacterial luciferase operon + G13 promoter
  • Alt name
    LuxABCDE
  • Species
    Mycobacterium marinum + Photorhabdus luminescens
  • Insert Size (bp)
    6186
  • Mutation
    It contains a gram-positive enhanced translation signal in front of luxA, luxC and luxE. G13 promoter cloned in front of luxC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer agaataacgttggcactcgc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.

Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMV306hsp+LuxG13 was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26161)
  • For your References section:

    Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722