pMV306hsp
(Plasmid #26155)

• Depositing Labs: Brian Robertson, Siouxsie Wiles
• Publication: Andreu et al PLoS One. 2010 May 24;5(5):e10777.

Backbone

• Vector backbone: pMV306
• Backbone size w/o insert (bp): 3938
• Vector type: Mycobacteria integrating vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hsp60 promoter
• Species: Mycobacterium bovis BCG
• Insert Size (bp): 435

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: aaccgtattaccgcctttga

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The hsp60 promoter was obtained from pSMT3
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are a few sequence discrepancies between author sequence and Addgene quality control sequence for the hsp promoter. The hsp promoter sequence was taken from the pSMT3 vector and is theoretical sequence. These differences do not affect function.

Garbe, T.R., et al., Transformation of mycobacterial species using hygromycin resistance as selectable marker. Microbiology, 1994. 140 ( Pt 1): p. 133-8.