-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306hsp
- Backbone size w/o insert (bp) 4373
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBacterial luciferase operon
-
Alt nameLuxABCDE
-
SpeciesPhotorhabdus luminescens
-
Insert Size (bp)5722
-
MutationIt contains a gram-positive enhanced translation signal in front of luxA, luxC and luxE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer agaataacgttggcactcgc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.
Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306hsp+Lux was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26159 ; http://n2t.net/addgene:26159 ; RRID:Addgene_26159) -
For your References section:
Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722