Skip to main content
Addgene
Open Menu

pcDNA3.1(+)-Flag-SOD1 WT
(Plasmid #261728)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 261728 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)-N-DYK
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOD1 WT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    477
  • GenBank ID
    NM_000454 6647
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CMV enhancer
  • Tag / Fusion Protein
    • Flag tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-Flag-SOD1 WT was a gift from Chen Seng Ng (Addgene plasmid # 261728 ; http://n2t.net/addgene:261728 ; RRID:Addgene_261728)

  • For your References section:

    A Phase-Resolved Geometric Deep Learning Framework Maps Structural Determinants of Disease-Associated Protein Aggregation and Guides Suppressor Design. Sio JS, Loo WXW, Loo YS, Tan WX, Lim HX, Liu H, Ng CS. Adv Sci (Weinh). 2026 Jun 17:e76118. doi: 10.1002/advs.76118. 10.1002/advs.76118 PubMed 42307331
Related items: