Skip to main content
Addgene
Open Menu

pHDR
(Plasmid #262549)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 262549 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pHDR (modified pEG BacMam system)
  • Backbone manufacturer
    Ruan Lab (Thomas Jefferson University)
  • Backbone size (bp) 8103
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Gentamicin
  • Tags / Fusion Proteins
    • GFP nanobody (C terminal on backbone)
    • 8xHis (C terminal on backbone)
    • Strep-Tag II (C terminal on backbone)
    • FLAG (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ctttctctccacaggtgtcc
  • 3′ sequencing primer ctccggcttcagactgttcatttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHDR was a gift from Zheng Ruan (Addgene plasmid # 262549 ; http://n2t.net/addgene:262549 ; RRID:Addgene_262549)

  • For your References section:

    GFP-Nanobody-Based Fluorescence-Detection Size-Exclusion Chromatography (FSEC) Method for the Expression Screening of Membrane and Secreted Proteins. Dowarha D, Hang DB, Ruan Z. Methods Mol Biol. 2026;3020:87-102. doi: 10.1007/978-1-0716-5186-5_6. 10.1007/978-1-0716-5186-5_6 PubMed 42681341
Related items: