pCIRCUS dTomato + WT mascRNA + Tornado-Split eGFP
(Plasmid
#262677)
-
PurposeCIRCUS platform enabling co-expression of a linear dTomato mRNA, wildtype mouse mascRNA, and a circRNA encoding scarred eGFP. The Tornado platform drives circRNA production.
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 262677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerLife Technologies
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedTomato
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses mascRNA, eGFP
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIRCUS dTomato + WT mascRNA + Tornado-Split eGFP was a gift from Jeremy Wilusz (Addgene plasmid # 262677 ; http://n2t.net/addgene:262677 ; RRID:Addgene_262677)
