pUbiq-sh_vg-HSVTK_α1
(Plasmid
#262817)
-
PurposeGoldenBraid α1 intermediate plasmid containing a Ubiquitin promoter-driven short hairpin RNA targeting the Drosophila melanogaster vestigial (vg) gene, followed by an HSV-TK terminator.
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in the United States of America -
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 262817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAlpha1x
-
Vector typeGoldenBraid Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTwo shRNAs targeting vestigial (vg)
-
gRNA/shRNA sequenceTTGTCTGAATAAGTCGCACTTG, TCCTTGAGCACCGACAGCCAG
-
SpeciesD. melanogaster (fly)
-
Entrez Genevg (a.k.a. Dmel_CG3830, CG3830, Dmel\CG3830, VG, Vg, vg21)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUbiq-sh_vg-HSVTK_α1 was a gift from Jeff Sekelsky (Addgene plasmid # 262817 ; http://n2t.net/addgene:262817 ; RRID:Addgene_262817)
Map uploaded by the depositor.
