pCas-LbCas12a-K932G-N933G-S934A-R935G_pCB482-p15A
(Plasmid #262848)

• Purpose: LbCas12a Lid variant K932G/N933G/S934A/R935G, constitutively expressed from PJ23108 in E. coli. Used in the in vivo nicking screen. Chloramphenicol, p15A.
• Depositing Lab: John van der Oost
• Depositing Organization: Wageningen University, Department Agrotechnology & Food Sciences
  Located in the Netherlands
• Publication: Size and sequence variation of the Lid of the Cas12a nuclease domain results in a nickase phenotype (unpublished)

Backbone

• Vector backbone: pCB482
• Backbone manufacturer: Beckwith Lab (pACYC184-derived, p15A origin)
• Backbone size w/o insert (bp): 4067
• Total vector size (bp): 7751
• Modifications to backbone: LbCas12a expressed from the constitutive PJ23108 promoter
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Cloned and propagated in E. coli DH10B, LB at 37 C with chloramphenicol. No special propagation requirement is known; standard recA1 endA1 cloning strains are expected to be suitable.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: LbCas12a
• Alt name: LbCpf1
• Alt name: Cas12a
• Alt name: Cpf1
• Species: Lachnospiraceae bacterium ND2006
• Insert Size (bp): 3684
• Mutation: K932G, N933G, S934A, R935G in the RuvC Lid
• Promoter: PJ23108 (constitutive)

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: CCACACTGTCGTACGATGTCTAT
• 3′ sequencing primer: CACCGATGCAGATTATATCAAAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry