pET-6xHis-LbCas12a-Lid2
(Plasmid #262851)

• Purpose: N-terminally His6-tagged LbCas12a Lid2 nickase for IPTG-inducible expression and purification from E. coli Rosetta (DE3). Kanamycin, T7/lacO.
• Depositing Lab: John van der Oost
• Depositing Organization: Wageningen University, Department Agrotechnology & Food Sciences
  Located in the Netherlands
• Publication: Size and sequence variation of the Lid of the Cas12a nuclease domain results in a nickase phenotype (unpublished)

Backbone

• Vector backbone: pET (pDS015-derived)
• Backbone manufacturer: In-house pDS015 His6-TEV expression backbone
• Backbone size w/o insert (bp): 5347
• Total vector size (bp): 9004
• Modifications to backbone: LbCas12a-Lid2 inserted by Gibson assembly into the pDS015-derived pET backbone (backbone primers BG25100/BG25099; insert primers BG25168/BG25169). The N-terminal 6xHis-TEV cassette is retained from the backbone.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Cloned and propagated in E. coli DH10B, LB at 37 C with kanamycin. For protein expression, transform E. coli Rosetta (DE3): grow in LB at 37 C to OD600 ~0.6-0.8, induce with 0.1-0.5 mM IPTG and incubate overnight at 18 C. The N-terminal 6xHis tag is not cleaved.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LbCas12a
• Alt name: LbCpf1
• Alt name: Cas12a
• Alt name: Cpf1
• Species: Lachnospiraceae bacterium ND2006
• Insert Size (bp): 3657
• Mutation: G930Y, F931C, K932S, N933S plus deletion of residues 934-941 (YCSS motif) in the RuvC Lid
• Promoter: T7 / lacO (IPTG inducible)
• Tag / Fusion Protein:
  • 6xHis followed by a TEV protease site (TEV not used; the His tag is retained in the purified protein) (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTCCCCATCGGTGATGTC
• 3′ sequencing primer: CTCAAGACCCGTTTAGAGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry