pRFP-PS2-crRNA2-reporter-LbCas12a_pBR322
(Plasmid #262855)

• Purpose: RFP reporter carrying protospacers PS1 and PS2 and a constitutive LbCas12a crRNA array, for the in vivo nicking screen in E. coli. Ampicillin, pBR322.
• Depositing Lab: John van der Oost
• Depositing Organization: Wageningen University, Department Agrotechnology & Food Sciences
  Located in the Netherlands
• Publication: Size and sequence variation of the Lid of the Cas12a nuclease domain results in a nickase phenotype (unpublished)

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 3839
• Total vector size (bp): 4517
• Modifications to backbone: Carries protospacers PS1 and PS2 in an inverted arrangement for the paired-nick readout. LbCas12a crRNA cassette (J23119 promoter, direct repeat, spacer 2) introduced by BbsI Golden Gate with BG25643/BG25644. The target sites lie in non-coding sequence, not in the RFP gene.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Cloned and propagated in E. coli DH10B, LB at 37 C with ampicillin. Used together with a pCas LbCas12a plasmid (chloramphenicol) and the pGFP reporter (kanamycin) in the in vivo nicking screen; loss of this reporter reports cleavage.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RFP
• Alt name: rfp
• Species: Synthetic
• Insert Size (bp): 678
• Promoter: J23119 (crRNA cassette)

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: GGGTAAGGTTTCCCATCGTT
• 3′ sequencing primer: CCCGGACTACCTGAAACTGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry