pCMV6-Nrf1-EGFP
(Plasmid
#262892)
-
PurposeExpresses Nrf1 fused with EGFP under control of CMV promoter.
-
Depositing Lab
-
Depositing OrganizationRutgers, The State University of New Jersey
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 262892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 262892-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 262892-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV6
-
Backbone manufacturerOriGene
- Backbone size w/o insert (bp) 4122
- Total vector size (bp) 7032
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNrf1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1527
-
GenBank IDNM_001164226
-
Entrez GeneNrf1 (a.k.a. D6Ertd415e)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer caccaaaatcaacgggactt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byModified from OriGene plasmid MR226726, pCMV6-Nrf1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 262892-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 262892-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-Nrf1-EGFP was a gift from Ronald Hart (Addgene plasmid # 262892 ; http://n2t.net/addgene:262892 ; RRID:Addgene_262892) -
For your References section:
ATM is activated by ATP depletion and modulates mitochondrial function through NRF1. Chow HM, Cheng A, Song X, Swerdel MR, Hart RP, Herrup K. J Cell Biol. 2019 Mar 4;218(3):909-928. doi: 10.1083/jcb.201806197. Epub 2019 Jan 14. 10.1083/jcb.201806197 PubMed 30642892
Map uploaded by the depositor.
