pNRP050-TaDAB1-H229A
(Plasmid #263219)

• Purpose: inducible T. albus dab1 operon with dabB mutant and no pII protein in pFE backbone
• Depositing Lab: David Savage
• Depositing Organization: University of California, Berkeley
  Located in the United States of America
• Publication: Phillips et al Proc Natl Acad Sci U S A. 2026 Oct 20;123(42):e2616712123. doi: 10.1073/pnas.2616712123. Epub 2026 Oct 12.

Backbone

• Vector backbone: pFE
• Total vector size (bp): 8419
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Probable Inorganic Transporter subunit DabBC
• Species: Thermocrinis albus
• Insert Size (bp): 2280
• Mutation: Changed Histidine 229 to Alanine
• Promoter: Tet

Cloning Information for Gene/Insert 1

• Cloning method: Golden Gate
• 5′ sequencing primer: ataggcgtatcacgaggccc

Gene/Insert 2

• Gene/Insert name: Probably Inorganic Carbon Transporter Subunit DabA1
• Species: Thermocrinis albus
• Insert Size (bp): 3000

Cloning Information for Gene/Insert 2

• Cloning method: Golden Gate
• 5′ sequencing primer: ggttcaccttgggagttgcc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Purchased Dab genes as codon optimized gBlock from Twist

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.64898/2026.05.01.722082 for bioRxiv preprint.