Skip to main content
Addgene
Open Menu

pJJD019-HnDAB2-H260A
(Plasmid #263220)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 263220 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pFE
  • Total vector size (bp) 7317
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Probably Inorganic Carbon Transporter Subunit DabB2
  • Species
    Halothiobacillus neapolitanus
  • Insert Size (bp)
    1656
  • Mutation
    Histidine 260 mutated to Alanine
  • Promoter Tet

Cloning Information for Gene/Insert 1

  • Cloning method Golden Gate
  • 5′ sequencing primer ataggcgtatcacgaggccc
  • 3′ sequencing primer TCGATGACAAATTCAGATACTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Probably Inorganic Carbon Transporter Subunit DabA2
  • Species
    Halothiobacillus neapolitanus
  • Insert Size (bp)
    2484
  • Promoter N/A

Cloning Information for Gene/Insert 2

  • Cloning method Golden Gate
  • 5′ sequencing primer TCGCCTTGTTTGTTCAC
  • 3′ sequencing primer tagcacgcgtaccatgggat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2026.05.01.722082 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJJD019-HnDAB2-H260A was a gift from David Savage (Addgene plasmid # 263220 ; http://n2t.net/addgene:263220 ; RRID:Addgene_263220)

  • For your References section:

    Structural insights into the coupling mechanism of vectorial CO(2) uptake by DAB1. Phillips NR, Oltrogge LM, Remis JP, Savage DF. Proc Natl Acad Sci U S A. 2026 Oct 20;123(42):e2616712123. doi: 10.1073/pnas.2616712123. Epub 2026 Oct 12. 10.1073/pnas.2616712123 PubMed 42863049
Related items: