Skip to main content

pCBFRE-(mt)-luc
(Plasmid #26896)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26896 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 26896-D50 50 μg of DNA in Tris buffer $495
DNA 26896-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Unknown
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CBFRE
  • Alt name
    CBF1-responsive element
  • Insert Size (bp)
    144
  • Mutation
    Mutated CBF1 sites (see note)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of Luciferase. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBFRE-(mt)-luc was a gift from Nicholas Gaiano (Addgene plasmid # 26896 ; http://n2t.net/addgene:26896 ; RRID:Addgene_26896)
  • For your References section:

    Notch signaling activation in human embryonic stem cells is required for embryonic, but not trophoblastic, lineage commitment. Yu X, Zou J, Ye Z, Hammond H, Chen G, Tokunaga A, Mali P, Li YM, Civin C, Gaiano N, Cheng L. Cell Stem Cell. 2008 May 8. 2(5):461-71. 10.1016/j.stem.2008.03.001 PubMed 18462696