VCVV
(Plasmid
#27789)
-
Depositing Lab
-
Depositing OrganizationNational Institute on Alcohol Abuse & Alcoholism (NIAAA)
Located in the United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 27789-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 27789-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3940
-
Vector typeMammalian Expression ; Stoichiometry standard
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-Cerulean-Venus-Venus
-
Alt nameVCVV
-
Insert Size (bp)2826
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 1st Venus can be excised using a NheI-BSP E1 double digest; Cerulean by BSP E1-BglII; the 2nd Venus by BglII-SalI and the last (3rd) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.
Due to the multiple fluorescent protein repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.
DNA (Catalog # 27789-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 27789-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VCVV was a gift from Steven Vogel (Addgene plasmid # 27789 ; http://n2t.net/addgene:27789 ; RRID:Addgene_27789) -
For your References section:
Anomalous surplus energy transfer observed with multiple FRET acceptors. Koushik SV, Blank PS, Vogel SS. PLoS One. 2009 Nov 25;4(11):e8031. doi: 10.1371/journal.pone.0008031. 10.1371/journal.pone.0008031 PubMed 19946626