-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9204
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAL-Backbone(NI)
-
Alt nameBackbone(NI)
-
SpeciesSynthetic
-
Insert Size (bp)2349
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTTTGAGTTTGGATCTTGGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EF1a-Backbone(NI) was a gift from Feng Zhang (Addgene plasmid # 27962 ; http://n2t.net/addgene:27962 ; RRID:Addgene_27962) -
For your References section:
Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Feb;29(2):149-53. doi: 10.1038/nbt.1775 10.1038/nbt.1775 PubMed 21248753