-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 27967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJ201
- Backbone size w/o insert (bp) 2672
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAL-monomer-NG
-
Alt namemonomer-NG
-
SpeciesXanthomonas
-
Insert Size (bp)102
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GATGGTAGTGTGGGGACTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA 2.0
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
monomer-NG was a gift from Feng Zhang (Addgene plasmid # 27967 ; http://n2t.net/addgene:27967 ; RRID:Addgene_27967) -
For your References section:
Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Jan 19. ():. 10.1038/nbt.1775 PubMed 21248753