Skip to main content

pQStrep2-ARPC3
(Plasmid #31580)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31580 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pQStrep2
  • Backbone size w/o insert (bp) 3460
  • Modifications to backbone
    GenBank: AY028642
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Actin related protein 2/3 complex, subunit 3
  • Alt name
    PSFEp758G0811
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    603
  • GenBank ID
    DQ000507
  • Entrez Gene
    ARPC3 (a.k.a. ARC21, p21-Arc)
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • StrepII-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.

Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQStrep2-ARPC3 was a gift from Konrad Buessow (Addgene plasmid # 31580 ; http://n2t.net/addgene:31580 ; RRID:Addgene_31580)
  • For your References section:

    Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5;4:21. doi: 10.1186/1475-2859-4-21. 10.1186/1475-2859-4-21 PubMed 15998469