-
PurposeMammalian expression of blue-green emission ratiometric genetically encoded Ca2+ indicator for optical imaging
-
Depositing Lab
-
Depositing OrganizationUniversity of Alberta
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 32442-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 32442-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGEM-GECO1
-
Alt nameemission ratiometric genetically encoded Ca2+-indicators for optical imaging
-
Speciessynthetic construct
-
Insert Size (bp)1248
-
MutationGCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S404G/E430V
-
GenBank IDJN258409
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Could not make stable cell line using this vector.
Addgene's sequencing result identified a single nucleotide mismatch at position 1182 when compared to the sequence provided by the depositing scientist and GenBank ID JN258409. According to the depositing scientist, this mismatch does not affect the protein sequence and is not a concern for the function of the plasmid.
DNA (Catalog # 32442-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 32442-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-GEM-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32442 ; http://n2t.net/addgene:32442 ; RRID:Addgene_32442) -
For your References section:
An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 30;333(6051):1888-91. doi: 10.1126/science.1208592 10.1126/science.1208592 PubMed 21903779