Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32448)


Item Catalog # Description Quantity Price (USD)
Plasmid 32448 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    blue intensiometric genetically encoded Ca2+-indicators for optical imaging
  • Insert Size (bp)
  • Mutation
    GCaMP3 S40P/L60P/D86G/K119I/L173Q/T223S/Y224H/D305G/R377P/K380Q/ S404G
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Note: Could not make stable cell line using this vector.

There is 1bp mismatch between Addgene's quality control sequence and the provided depositor's sequence, P5S in protein sequence. This mutation should not affect the protein function and the depositing lab confirmed that in vivo experiment before.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-B-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32448 ; ; RRID:Addgene_32448)
  • For your References section:

    An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 8. 10.1126/science.1208592 PubMed 21903779