pCAG:H2B-EGFP
(Plasmid #32599)

• Depositing Labs: Anna-Katerina Hadjantonakis, Virginia Papaioannou
• Depositing Organization: Memorial Sloan-Kettering Cancer Center
  Located in United States of America
• Publication: Hadjantonakis et al BMC Biotechnol. 2004 Dec 24;4:33.
• Citations: 2 Articles

Backbone

• Vector backbone: pCAGGS
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B-EGFP
• GenBank ID: X00088 X57127
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: IMR 872 AAGTTCATCTGCACCACCG
• 3′ sequencing primer: IMR 873 TGCTCAGGTAGTGGTTGTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the plasmid contains a duplication of the H2B-EGFP region as compared to the original depositor sequence. The depositor has confirmed that the plasmid functions as described in the associated publication.

The coding sequence for the human histone H2B gene
(X57127) was amplified from genomic DNA by PCR
using Pfx Polymerase (Invitrogen). The resulting product
was cloned into pCR4 TOPO (Invitrogen) to generate
pH2B. The H2B fragment was then cloned into plasmids
pEGFP-N1, pDsRed2-N1 pDsRedExpress-N1 (BD Biosciences, Inc) in order to generate plasmids pH2B-EGFP,
pH2B-DsRed2 and pH2B-DsRedExpress (oligonucleotide
sequences are available upon request). The resulting
fusions were then re-amplified by PCR and cloned into
the XhoI site of pCAGGS [19] to generate pCX-H2B-EGFP,
pCX-H2B-DsRed2 and pCX-H2B-DsRedExpress.

DNA (Catalog # 32599-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 32599-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.