pCS2+8NmCherry-ABCC5a
(Plasmid
#35207)
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 35207-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 35207-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCS2+8NmCherry
-
Backbone manufacturerGokirmak et al., 2012
- Backbone size w/o insert (bp) 4866
-
Vector typeMammalian Expression ; Sea urchin, zebrafish, Xenopus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABCC5a
-
Alt nameMRP5
-
SpeciesStrongylocentrotus purpuratus
-
Insert Size (bp)4284
- Promoter SP6
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer CTTGAAGCTGTCCTTCCCCGA
- 3′ sequencing primer TGTTGTTAACTTGTTTATTGCAGCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 35207-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 35207-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+8NmCherry-ABCC5a was a gift from Amro Hamdoun (Addgene plasmid # 35207 ; http://n2t.net/addgene:35207 ; RRID:Addgene_35207) -
For your References section:
Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201